final protocol of herpes

After reading hundreds of websites about the Final Protocol Herpes Melanie Addington, you must be wondering if this is a scam or a truly effective product. Before answering that question, I would give my honest opinion and description about the product, because I was a victim of this condition. The truth is that I am about to reveal been highly controversial, so before opting for the book, it is very important that you know that many have achieved incredible results, while others do not. The truth is that they are very contrary opinions, and after reading hundreds of websites on the internet about Herpes, I found 2 types of opinions: On one side are those who say that herpes is incurable. Even doctors and some medical experts say the Herpes can be controlled with the use of drugs but it is not possible to cure fully. I have received hundreds of emails based on that scoop, stating that the Final Protocol Herpes is a scam, because their doctors have said that herpes has no cure. I discovered . . . What I have discovered is that people who say this have not even trying to buy the Final Protocol Herpes, and give opinions based solely on information from what they have heard from a doctor, or family member who has informed them. Even, some people only get “assumptions” or “Opinions” baseless. These people have simply heard out there what others say, and only repeat the same baseless.

On the other hand people who have completed the protocol and are surprised with the results are. It is true that at first, all this information quite confused, and that generated me doubt whether to trust the program or not. Would it be possible that with a book that teaches natural treatments to eliminate Herpes definitely could have results? Some of my biggest doubts After seeing the video explaining the program I was left with many questions, but I really was excited. Deep inside me, I knew I could be a risk, because today is very fashionable internet scams. But after seeing the product satisfaction guarantee, backed by the company marketing the product, and know that if they do not meet the promises can claim back 100% of my money, I calmed. Finally, “Nothing ventured, nothing gained” Actually there are many negative people who always think of scams and nothing will work, and precisely with that attitude is that they never do anything to solve their problems. So I decided to ignore all the negative information I found and make the decision to acquire the Final Protocol of Herpes. What is the Final Protocol of Herpes The PDH (Final Protocol Herpes) is a program that was created to treat herpes, which has been listed by traditional medicine as almost impossible to cure, however the cure for herpes has been around for thousands of years, only the billion dollar pharmaceutical industry has hidden from us the whole truth to be followed enriching. Before being officially launched the program, it was tested in many people.

Melanie has received thousands of emails that have been sent from all over the world, thanking him for his great help. This is perhaps one of the evidence that the program works. But perhaps the most important testimony of all these is mine. Yes, it sounds embarrassing, I also suffered the uncomfortable symptoms of Herpes, however, thanks to the confidence generated Melanie me, myself implement the program, and this also worked for me. What brings the treatment of Herpes? Initially, the program speaks of all possible types of herpes, its symptoms and its prevalence. After that, and know what exactly the kind of herpes that can be, continued the program with 3 major steps: 1. To strengthen the immune system. This step is taught how to turn our bodies into a wall impenetrable proof bullets. You will learn the secrets that will make your immune system work 24 hours a day, protecting all bacteria and viruses that try to catch it. 2. Destroying the virus

The second step is permanently eliminate the virus, killing it at the root, thanks to a series of 100% natural components. No drugs or expensive drugs and lifetime. Here they teach you how to combat any virus, with simple foods that get in any supermarket in the corner near his home. Thanks to this treatment, the virus will definitely go and you regain your health. 3. extreme Prevention In this step of the program, Melanie will teach you how to stop the virus reproducing that follow, and avoid relapse. This treatment will teach your body how to be safe and sure not to get sick again. This is perhaps one of the most important aspects of the book, because through natural processes, will prevent relapse again. Finally the book ends giving advice on how to keep your body healthy, and how to make your immune system is 100% attentive to any disease. Pros and Cons of the Final Protocol of Herpes Pros It will eliminate the Herpes permanently from your body.

It is much more natural and economical implement this alternative to be spending money on drugs lifetime. It will strengthen your immune system against other bacteria and viruses. If you have not had results in 60 days, you may request a refund of 100% of your money. NOTHING TO LOSE! ! Against It is not available in physical book. Only you can download it in PDF (E-Book) format. It is not a miraculous method, you have to have discipline and implement it for at least 60 days. Depending on each case, in this period of time the results will be. If you do not have the discipline to take treatment daily, this program is not for you. My personal opinion There will always be people with opinions and different ways of thinking, really that’s very respectable.

Therefore, what I say below is just my way of seeing things. For years I was taking drugs that recommended me pharmacies. These came with major side effects. I felt my hair began to fall more easily. And every time I asked about alternative medicines, the answer was the same, that would not heal Herpes. True, to buy the book you have to pay, however the value I received from this alternative treatment is much less than it would cost me frequent doctor appointments, medications send me for life, transport to up appointments, etc. And I ask you, Your doctor will return 100% of your money if the treatment does not work? Do you think taking medications for life is a viable solution? The author of this book has expressed its desire to increase the cost of it due to the great success he is having. More than 7,500 people have bought this book and the number continues to rise. Will you continue going embarrassments? Will you continue with the unbearable itching? The final protocol herpes can really help eliminate herpes definitely.

But you will find the power to make a wise decision. Remember that there is no risk, and only you win. Click here to download the book of the Final Protocol to the Herpes of their official website and permanently eliminate herpes from your life.

Genital herpes is a Russian roulette

By Elizabeth Araujo / National / Venezuela 09/10/2013 | 10: 22 a. m. Maria Gabriela finally decides to go to the gynecologist. 23 years old and with a somewhat intense sexual activity, he does not believe that inflammation in the vulva, burning urination, itching and annoying vaginal discharge, partner with your evenings secretly with Luis, her first boyfriend and fellow college. But once the specialist examines he ensures that young unwittingly has pulled the trigger of genital herpes. “Sexually transmitted diseases are a kind of Russian roulette in which young people generally lose misinformed about sex,” says Blanca de Molina, a gynecologist and mother of two teenage girls. Curricular enough data to know, as he repeats his daughters, that prevention is a free, infallible and without side effects pill. A Maria Gabriela lacks some blood tests done to be sure that it will enter the statistics of young Venezuelans (approximately 30%) between 13 and 25 years old who have a sexually transmitted infection by not using protection during sexual intercourse . An alarming figure because, as noted Molina, at that age is when those lusty boys require information and advice from both the family and the school. Sick forever. According to specialists, genital herpes is the Trojan horse of sexually transmitted diseases, for their ability to concealment and damage it causes. This is a condition caused by a virus. Transmission is from person to person through sexual contact (intercourse, oral sex, anal, rubbing genitals).

Although there are 8 types of virus, the most common are the HSV-1, associated with oral herpes, and HSV-2 genital related. The possibility of transmitting the disease even without the presence of visible lesions is difficult to predict, but there are women with cervical lesions or men with intraurethral lesions that are transmitters. About 70% of new cases of herpes are transmitted by asymptomatic persons at the time of infecting partner. The lesions appear as blisters, two weeks after infection and usually appear as if flu: headache, fatigue, joint pain, fever and discomfort in lower back. Often the inguinal lymph nodes to swell. In some people especially women and if there are injuries labia majora and / or lower, there may be burning and painful urination, vaginal discharge and itching. There are certain favorable circumstances for the virus, such as frequent exposure to sunlight, stress, immune suppression or skin trauma, which allow herpes is reactivated and then migrate to the skin. When the disease enters the body staying at the sensory nerve endings, circulating through them to the neural ganglia. Then it is dormant. Molina regrets that, due to lack of information, the patient almost always go in late, when the initial lesions tend to break and join with each other, forming ulcers or sores in the affected area. Women are more affected by genital herpes than men. For every 10 cases of 6 to 7 are women. Although varies by age usually occurs in people who begin sexual relations earlier (between 12 and 18 years).

An additional danger because it is the golden age of reproductive age. Prevention. Molina advised whenever examining a teenager the only infallible for sexually transmitted infections is prevention pill, resulting in safer sex and relationships with a fixed partner. Although it is almost impossible in these times, the specialist insists that it should advise adolescents to retard “the first time” until the moment they decide to establish a stable relationship. If the member of a couple has presented the disease, it is advisable to see a doctor to guide them both. “Please note that the diagnosis of genital herpes is not the end of sexual life,” says Molina, suggesting pregnant not make love without a condom, in order to avoid any infection. If a person has active herpes lesions better avoid intimacy. All human beings should use condoms to protect themselves and protect other STIs.

Some home remedies for your dog – Labrador Retriever Forum

Many times the pet (dog or cat) to be at home has some drawbacks such as fleas or ticks that may even cause illness. There are several natural remedies that help control and even completely eliminate these nuisances. The fleas Fleas can cause anemia and transmit diseases and parasites. There are some home remedies to control fleas naturally: Fleas remedy # 1: Mix 80 ml of alcohol over 70 ° with 5 ml of essential oil of tea tree in 15 ml of distilled water. Place in a large spray bottle and spray the dog’s fur especially after regular bathing. Do not rinse and dry. Perform this action out of home Flea remedy # 2: Boil several sheets of pennyroyal in 1 gallon of water for 20 minutes. Remove from heat, drain and place in a spray bottle. Spraying outside the home, to coat the pet. Flea remedy # 3: Add the water bath oils eucalyptus A flea-infested dog really need a bath every two weeks; a cat, once a month.

Flea remedy # 4: Cut a lemon into slices and then add two cups of water almost to boiling. Remove from heat and let stand overnight. The next day, applied with a sponge on dog preparation. Do not rinse and dry. Flea remedy # 5: Add garlic and brewer’s yeast to the daily diet of the pet. Remedy against fleas # 6: Trying to rub your pet’s hair with brewer’s yeast. recommendations Brush daily. Using a fine tooth comb against fleas if the animal’s hair is short enough for this technique. Wash pet bedding in hot water and soap once a week and dry with a hot dryer Carpets vacuumed every two to three days ticks Ticks are a type of arachnids that live parasitically on the skin of animals such as dogs and cats.

It is capable, with its mouthparts pierce the skin to suck blood. They are located preferably in the ears. If you notice that the pet is very itchy and dark waste such as coffee, at the bottom of the ears, it is important to verify immediately the presence of ticks in that area. If you find ticks, you can apply the following home remedies: Remedy against ticks # 1: Mix 2 tablespoons of olive oil y1 liter of alcohol. After facilitates removal or detachment of the tick. Remedy against ticks # 2: Mix 15 ml of almond oil and vitamin E capsule in a dropper bottle, apply the content in both ears once a day for three days. Give a massage to the ear. This oily mixture smothers ticks and helps healing. Refrigerate the mixture when not in use and heat before using. Remedy against ticks # 3: Apply aloe vera gel or aloe vera with a swab in the ears of the pet to attack ticks. recommendations Clean the ears as a preventive measure ears of dogs and cats require regular attention and care.

Therefore, cleanliness is essential. Ideally, use, every week, a cotton ball soaked in warm mineral oil. It should be checked with more care, breeds with hanging ears like the cocker and basset, since they have the ear canal closed by the pinna, so you can easily convert into a nest of ticks. Check if there is any injury. If you find that the animal has hurt the ear because it has continually scratching in the area due to the presence of ticks, it should hold a cotton ball soaked in hydrogen peroxide and apply firmly to the wound. Carefully comb pet If the dog after a walk in the countryside presents ticks on your hair, you must pass a fine comb flea teeth, as this will catch ticks that have not been attached to the skin. Do not try to boot to force ticks. should not start to force ticks, since the body usually follows arachnid head which remain subject to the animal’s ear and can cause an infection. It is considered best to place a needle burning (taking care not to touch the skin of the pet) on the tick so that, for a reflex action, release the pet. When you go to the vet Go to the vet immediately if your pet exhibits any of these symptoms. Blood in the stool, bleeding from mouth and rectum, or vomiting and diarrhea can be signs of many diseases, including internal bleeding poisoning. abundant every half hour or full hour without eating or drinking in the middle diarrhea, can cause shock.

Shortness of breath, especially with blue gums can be a sign of heart disorder. Attacks. They should be immediately referred to the vet. The cause could be poisoning. Do not try to restrain the animal during seizures. Enter your search terms. Submit search form web remediospopulares. com Feng Shui course reflexology and reiki gift and manuals Note: These remedies should not replace medical treatment; They are only a supplement and the author is not liable for its use and consequences of use www. remediospopulares.

com All rights reserved. The content of this page is not free to be used elsewhere and should not be copied without permission. Subscribe to folk remedies Alternative medicine acupressure aromatherapy auriculoterapia Ayurveda chromotherapy frutoterapia hydrotherapy Homeopathy Bach flowers

Therapeutic massage Reiki Laughter Therapy treatments compresses Yoga Advertising Popular remedies: Acidity Acne aphrodisiacs Alcoholism allergies

Tonsillitis Anemia Arthritis Anxiety Asthma Bronchitis Bursitis Kidney stones Calluses Fatigue scarring Cystitis Circulation


Cholesterol bruises Conjunctivitis Give up smoking depressions Low defenses Diabetes Diarrhea Headache Neck Pain Back pain Toothache Menstrual pain

Eczema Constipation Stress Flatulence Fever forunculos Gastritis Gingivitis Drop Grain Halitosis (bad breath) Hemorrhoids Genital herpes

Herpes labialis Hypertension Hiccup Hypotension or low pressure impotence urinary incontinence Indigestion infertility vaginal infections Insomnia Lactose intolerance Laryngitis chapped lips

Mouth sores dizziness Memory Menopause Migraine Sickness Tired eyes styes Osteoporosis Intestinal parasites Insect bites Athlete’s foot Prostate

Psoriasis Burns Hangover colds Rheumatism Fluid retention Snoring Sinusitis Tachycardia Perspiration Cough Ulcers Ingrown toenails

Varicose veins warts vitiligo REMEDIES FOR YOUR DOG HOME Many times the pet (dog) who have at home has some drawbacks such as fleas or ticks that may even cause illness. There are several natural remedies that help control and even completely eliminate these nuisances. The fleas Fleas can cause anemia and transmit diseases and parasites. There are some home remedies to control fleas naturally: Fleas remedy # 1: Mix 80 ml of alcohol over 70 ° with 5 ml of essential oil of tea tree in 15 ml of distilled water. Place in a large spray bottle and spray the dog’s fur especially after regular bathing. Do not rinse and dry. Perform this action out of home

Flea remedy # 2: Boil several sheets of pennyroyal in 1 gallon of water for 20 minutes. Remove from heat, drain and place in a spray bottle. Spraying outside the home, to coat the pet. Flea remedy # 3: Add the water bath oils eucalyptus A flea-infested dog really need a bath every two weeks; a cat, once a month. Flea remedy # 4: Cut a lemon into slices and then add two cups of water almost to boiling. Remove from heat and let stand overnight. The next day, applied with a sponge on dog preparation. Do not rinse and dry. Flea remedy # 5: Add garlic and brewer’s yeast to the daily diet of the pet. Remedy against fleas # 6: Trying to rub your pet’s hair with brewer’s yeast. recommendations Brush daily. Using a fine tooth comb against fleas if the animal’s hair is short enough for this technique.

Wash pet bedding in hot water and soap once a week and dry with a hot dryer Carpets vacuumed every two to three days ticks Ticks are a type of arachnids that live parasitically on the skin of animals such as dogs and cats. It is capable, with its mouthparts pierce the skin to suck blood. They are located preferably in the ears. If you notice that the pet is very itchy and dark waste such as coffee, at the bottom of the ears, it is important to verify immediately the presence of ticks in that area. If you find ticks, you can apply the following home remedies: Remedy against ticks # 1: Mix 2 tablespoons of olive oil y1 liter of alcohol. After facilitates removal or detachment of the tick. Remedy against ticks # 2: Mix 15 ml of almond oil and vitamin E capsule in a dropper bottle, apply the content in both ears once a day for three days. Give a massage to the ear. This oily mixture smothers ticks and helps healing.

Refrigerate the mixture when not in use and heat before using. Remedy against ticks # 3: Apply aloe vera gel or aloe vera with a swab in the ears of the pet to attack ticks. recommendations Clean the ears as a preventive measure ears of dogs and cats require regular attention and care. Therefore, cleanliness is essential. Ideally, use, every week, a cotton ball soaked in warm mineral oil. It should be checked with more care, breeds with hanging ears like the cocker and basset, since they have the ear canal closed by the pinna, so you can easily convert into a nest of ticks. Check if there is any injury. If you find that the animal has hurt the ear because it has continually scratching in the area due to the presence of ticks, it should hold a cotton ball soaked in hydrogen peroxide and apply firmly to the wound. Carefully comb pet If the dog after a walk in the countryside presents ticks on your hair, you must pass a fine comb flea teeth, as this will catch ticks that have not been attached to the skin. Do not try to boot to force ticks. should not start to force ticks, since the body usually follows arachnid head which remain subject to the animal’s ear and can cause an infection. It is considered best to place a needle burning (taking care not to touch the skin of the pet) on the tick so that, for a reflex action, release the pet.

When you go to the vet Go to the vet immediately if your pet exhibits any of these symptoms. Blood in the stool, bleeding from mouth and rectum, or vomiting and diarrhea can be signs of many diseases, including internal bleeding poisoning. abundant every half hour or full hour without eating or drinking in the middle diarrhea, can cause shock. Shortness of breath, especially with blue gums can be a sign of heart disorder. Attacks. They should be immediately referred to the vet. The cause could be poisoning. Do not try to restrain the animal during seizures. UNTIL THEN TAKE CARE AND ESPECIALLY YOUR DOGS TAKE CARE AS THEY CARE TO YOU . . . THE PACHECO

CT and MRI findings of human herpesvirus-associated encephalopathy 6: comparison of herpes simplex findings With


OBJECTIVE: It is Important to differentiate human herpesvirus 6 (HHV-6) -associated from herpes simplex encephalitis encephalopathy (HSE). These conditions are like, Although With regard to Involvement of the mesial temporal lobe, HSE is sensitive to acyclovir but HHV-6 encephalopathy is not. We Compared the imaging findings of the two conditions. MATERIALS AND METHODS: We Encountered eight cases of HHV-6 encephalopathy and nine cases of HSE. We divided into an observation time early, middle, and late periods defined as 0-2, 3-30 and more than 30 days from the onset of neurologic symptoms. Differences Between HHV-6 encephalopathy and HSE on CT scans in the early period and in distribution and temporal Changes in the regions AFFECTED on MR images in the three periods Were Analyzed. RESULTS: At MRI in the early and middle periods, all eight Patients With HHV-6 encephalopathy HAD exclusive Involvement of the mesial temporal lobes, and all nine Patients With HSE HAD Involvement of Both the mesial temporal lobes and the extratemporal regions (p <0. 01). Among WHO Patients underwent MRI head, six of six With HHV-6 but none of six encephalopathy With HSE HAD resolution of high signal intensity on T2-weighted and FLAIR images (p <0. 01). Among Patients WHO underwent head CT in the early period, none of the four With HHV-6 encephalopathy and six of the seven With HSE HAD abnormal findings, treats including parenchymal swelling, Decreased attenuation of affected regions, and abnormal gyral enhancement (p <0. 05) . CONCLUSION: Serial MRI Showed abnormal transient signal intensity in the mesial temporal lobes in Patients With HHV-6 encephalopathy but persistent abnormal signal intensity in the mesial temporal lobes Both the extratemporal and regions in Patients With HSE. CT in the early period Showed no abnormality in Patients With HHV-6 encephalopathy but definite abnormal findings in Patients With HSE. These Differences May be useful in the differential diagnosis of the two conditions.

Medical Microbiology and Parasitology. Volume II: Section V. Virus: Chapter 61. Herpesvirus: Herpes 6

Available book full text in pdf version The rest of the parts of the book are also available in that format. If necessary you can download the product from Adobe “Acrobat Reader” to display the contents of the book in pdf format by accessing the following link: herpesvirus 6 Herpes 6 virus is the sixth member of the family of human herpesvirus and was first isolated in the laboratory of Robert Gallo at the National Cancer Institute in Bethesda, Maryland, USA, patients with a variety of lymphoproliferative disorders herpesvirus 6 . The human herpesvirus 6 is the sixth member of the family of human herpes virus was isolated for the first time, in 1986, in the laboratory of Robert Gallo at the National Cancer Institute in Maryland, USA from blood lymphocytes peripheral patients with a variety of lymphoproliferative disorders. The isolated virus was a lymphotropic and well distinguishable genetic and antigenic characteristics that differentiate it from all allowed herpesvirus hitherto isolated and placed in the subfamily b herpesvirinae virus. Properties virus The HHV6 genome DNA has a double-stranded, linear, with a size of 155-170 kbp and varies between different isolates. More recent studies, however, have revealed that the HHV6 is more closely related to CMV. It has been shown by analysis of the nucleotide sequence exists 66% sequence homology with CMV. It has been demonstrated by molecular biology techniques the existence of two virus variants: Variant A and B. Both differ in terms of biological, genetic and restriction patterns properties.

Most patients with sudden rash and like febrile illness seem to have HHV6 variant B. HHV6 isolates immunocompromised adult may belong to either variants and at least one patient found both virus variants. The virus has been isolated from peripheral blood mononuclear cells of patients with sudden rash, immunocompromised patients and healthy individuals. It has also been isolated with high frequency from the saliva of HIV-infected patients. The virus replicates in vitro preferably fetal or adult origin phytohemagglutinin-stimulated T lymphocytes. In infected cells they can be detected viral capsids at day 3 and mature virions after 5 days. Pathogeny The main target cell HHV6 appear to be CD4 + lymphocytes. Macrophages are persistently infected and may be an important reservoir. Transformed B lymphocytes, natural killer, megakaryocytes, glial cells, fibroblasts and epithelial cells are able to support the replication of certain strains of virus. Frequent isolations saliva herpesvirus 6 suggest that the virus resides and is removed from the salivary glands. The viral DNA and antigens have been identified in epithelial cells of the salivary glands and from different regions of the upper respiratory tract. So far it is assumed that herpesvirus 6 infection is transmitted by horizontal transmission, and there is no evidence of vertical transmission.

It has been suggested that the Herpes 6 can persist in monocytes / macrophages in a dormant state, although these are not exclusive primary site in vivo latency. The exact mechanism of reactivation of herpes 6 is not clear yet. It has been shown, however, that various types of transactivation can occur between herpes virus 6 and others including CMV, EBV, measles virus and HIV. Is a lymphotropic virus that infects susceptible individuals during the first year of life and generally cause lifelong latency. In a percentage variable, primary infection is followed by an acute illness of short duration, sudden rash. Older individuals may suffer an illness similar to mononucleosis or Kikuchi-Fujimoto disease. It is also capable of causing a wide range of hematopoietic, lymphoid and autoimmune disorders which have been associated with high titers of antibodies to herpes virus 6 and of which the virus has been isolated. These diseases include atypical polyclonal lymphoproliferation of Hogkin disease, chronic fatigue syndrome and systemic lupus erythematosus. General characteristics The herpesvirus 6 virus is ubiquitous in the human population. Infection occurs within the first two years of life; occasionally it is resulting in an acute febrile illness with or without sudden rash. Maternal antibodies are generally present at birth and decline in the first months of life. Seroconversion occurs in most cases between 6 and 18 months and the titles are high in adolescents.

Frequent isolations herpesvirus 6 of saliva suggests that the virus resides and is eliminated from the salivary glands. The viral DNA and antigens were identified in epithelial cells of the salivary glands and from different regions of the upper respiratory tract. So far it is assumed that herpesvirus 6 infection is transmitted by horizontal transmission and there is no evidence of vertical transmission. The most significant property of herpesviruses is their ability to produce a latent infection. During the acute phase of the disease, herpes DNA has been detected in 6 CD4 lymphocytes. During the convalescent phase of exanthem subitum 1. 5 to 2. 5 months after the onset of disease viral DNA is present in a population of adherent cells (monocytes), but not in lymphocytes. It has been suggested that the herpesvirus 6 may persist in monocytes / macrophages in a dormant state, although these are not exclusive primary site in vivo latency. The exact mechanism of reactivation of herpes 6 is not clear yet. Reactivation of the virus seems to occur spontaneously with other herpesviruses in the 5 to 20% of clinically asymptomatic population. It has been shown, however, that various types of transactivation can occur between herpes virus 6 and others including CMV, EBV, measles virus and HIV. clinical data


A variety of clinical disorders have been described as that may be associated with herpes infection 6. Based on current knowledge, which have been insufficient, diseases associated with herpes infection 6 have been classified into 2 groups: diseases caused by herpesvirus 6 infection and disease possibly associated with herpes 6, but without etiologic relationship clearly identified. The first group includes the sudden rash and child-like febrile illness with or without rash, infectious mononucleosis in the absence of heterophile antibodies and cases of Kikuchi disease. The second group consists of certain autoimmune disorders, chronic fatigue syndrome and lymphoid hematopoietic and proliferative diseases. In addition, they have been reported cases of fulminant hepatitis in immunocompromised patients and has been associated with reactivation of herpesvirus 6 and retinitis interstitial pneumonitis. Sudden rash. It is an acute disease that affects mainly small and young adults and is characterized by a short period of high fever (1-5 days) and the appearance of a rash which coincides with the period of defervescence usually occurs in summer and affects both sexes equally. It may be accompanied by sore throat and runny nose. There is absolute neutropenia with lymphocytosis of up to 90% and presence of atypical lymphoid cells with a plasmacytoid cytoplasm. The prognosis is good and does not require treatment. Other febrile illnesses. The virus has been isolated from children with acute febrile disease and otitis and in a percentage of cases the rash may be present. Other symptoms include malaise, irritability, nasal congestion, diarrhea, cough, vomiting.

The picture is benign and does not last more than 4 days. Infectious mononucleosis heterophile absence of Acs. It occurs frequently as a result of reactivation of latent infection by HHV6. The age of patients is the same as those with EBV mononucleosis. It is characterized by an indistinguishable exudative pharyngitis or membranous classical mononucleosis. Lymphadenopathy unlike the MI by the VEB, which tend to resolve in 11 days, may be present to more than 30 days and be associated with hepatosplenomegaly, lymphadenopathy retroperitoneal and blurred vision. Kikuchi disease: This is a histiocytic necrotizing lymphadenitis that has been recently reported. Reported cases come from Japan, Europe, the United States and other parts of Asia. Patients have not painful lymphadenopathy in neck and may or may not be accompanied by sore throat, fever, chills and myalgia. The age of patients ranges between 10and 60 years, with a predominance in 20. Other possible locations of the lymph nodes are axillary, and supraclavicular brachial region. Lymphadenopathy persist for months and can move on to a phase of chronic fibrosis. The prognosis with or without symptomatic treatment is good.

Transplant recipients. Virus reactivation in transplant recipients can lead to interstitial pneumonitis, encephalitis and rejection in some cases. Chronic fatigue syndrome. abruptly starts with a like syndrome accompanied influenza respiratory symptoms and / or gastrointestinal, fever, myalgia, arthralgia, fever, sore throat, unexplained general muscle weakness, excessive fatigue and prolonged postejercicios, neuropsychological symptoms, sleep disorders, among others. These are presented in various combinations, and due to variability among individuals, often the diagnosis of this syndrome is a problem for most doctors. Sjogren’s syndrome. It is an autoimmune disorder characterized by chronic inflammation with infiltration of exocrine glands that can progress to malignant lymphoma. The disease can occur in a primary form, without being associated with connective tissue disease or a secondary form attached artriris rheumatoid, systemic lupus erythematosus or other connective tissue disease. The characteristic and high diagnostic value triad is keratoconjunctivitis, xerostomia and polyarthritis. Any combination of these symptoms can be used for diagnosis. Immunological disturbances consist of functional defects, hyperactivity of B cells and natural killer deficient cells T cells. They can detect a variety of autoantibodies. Systemic lupus erythematosus.

The etiology of this disease is unknown and considered to be a viral infection, altered immune reactivity and genetic predisposition are responsible for the onset of disease. Many infectious agents, they can be imputed to cofactors in disease pathogenesis and herpesviruses are among them. Serological studies have shown high antibody titers against HHV6 in patients with systemic lupus erythematosus. Furthermore they have been detected in biopsy specimens of skin infected with the virus and in primary cultures of peripheral blood lymphocytes of these patients CD4 + / CD38 + was detected the virus genome by in situ hybridization and Acs by immunofluorescence. HHV6 and AIDS. Numerous virus isolates have been conducted in patients with AIDS. Because both viruses share target cell CD4 + lymphocytes, it is suggested that HHV6 is an important step in the progression to AIDS stage cofactor. This virus can cause retinitis in these patients. atypical lymphoproliferative disorders. Among the lymphoproliferative disorders related to infection by herpes virus 6 are: atypical polyclonal lymphoproliferation, non-Hodgkin lymphoma, hemophagocytic syndrome, among others. Finally, some researchers report the discovery of high antibody titers against herpes 6 in patients with myelodysplasia and chronic myeloproliferative syndromes (osteomielofibrosis and chronic myelogenous leukemia). Diagnosis The HHV6 can be isolated from patients with sudden rash during the febrile phase of the disease.

Samples are employed more often peripheral blood monocytes and saliva. These are inoculated on mononuclear cells prestimulated cord phytohemagglutinin. Furthermore, they can be used cell lines as HBS 2, the Sup T1 and Jurtka for variant A virus, and Molt 3 for variant B. The cytopathic effect appears between 5 and 9 days after inoculation the virus and is in rounding of the cells increase in size, merging with multinucleated giant cell formation and vacuolation. The virus can be confirmed by electron microscopy, immunofluorescence and immunoenzymatic assays for detecting antigens and molecular biology methods such as PCR and hybridization enable the detection of viral DNA in samples and in culture. Serological diagnosis is made by ELISA and indirect immunofluorescence using cells infected by the virus lymphoid origin. Epidemiology The herpesvirus 6 virus is ubiquitous in the human population. Is a lymphotropic virus that infects susceptible individuals during the first two years of life and generally cause lifelong latency. In a percentage variable, primary infection is followed by an acute illness of short duration, the sudden rash (children roseola or “sixth disease. ” The older individuals may suffer an illness similar to infectious mononucleosis or Kikuchi disease -Fujimoto. it is also capable of causing a wide range of hematopoietic, lymphoid and autoimmune disorders which have been associated with high titers of antibodies to the herpes virus 6 and of which the virus has been isolated. Maternal antibodies are generally present at birth and decline in the first months of life.

Seroconversion occurs in most cases between 6 and 18 months and the titles are high in adolescents. high titers of antibodies to herpes 6 have been observed in a number of diseases including immunocompromised persons; This suggests that reactivation of latent infection and exogenous reinfection occur with herpesvirus 6. So far it is assumed that herpesvirus 6 infection is transmitted by horizontal transmission through oropharyngeal secretions and there is no evidence of vertical transmission. Treatment Most primary infections do not require specific treatment. In case of related transplant recipients, fulminant hepatitis, hematopoietic disorders, autoimmune diseases lymphoid either the use of some antiviral. The virus is sensitive to foscarnet, ganciclovir and acyclovir relatively resistant.

Absence of human herpesvirus 6 DNA in CSF by nested PCR in patients with multiple

Introduction Always it has been suspected that viruses may play an important role in the pathogenesis of multiple sclerosis (MS) 1. Attempts have been attributed to some of them, so far unsuccessfully, as triggers the autoimmune response that leads to desmielinización2-6 plates. What one has established it is that certain viruses are causative agents four demyelinating diseases: progressive multifocal leukoencephalopathy (JC virus), post-infectious encephalitis (measles), encephalopathy human immunodeficiency virus (HIV) and myelopathy HIV. 7. As recently described attributable to human herpesvirus type 6 (HHV-6) in different pathologies pathogenetic role, highlighted in neurological diseases references associating it with EM8. In this regard they have shown higher antibody titers against HHV-6 in MS in controles9,10. It has also been detected by polymerase chain reaction (PCR) DNA of HHV-6 in serum mainly patients with MS type relapsing-remitting (EM-RR), unlike controles9 and by immunohistochemistry has been objectified HVH -6 in oligodendrocytes from areas of demyelination but also areas of apparently healthy white matter of patients who died with EM11. Very recently he turned to objectify by immunohistochemistry HHV-6 in MS white matter affected, but also in lymphoid tissue and by culture in peripheral blood leukocytes from these patients12. On the other hand, we know that the HHV-6 virus is cytopathic for CD4 + T lymphocytes, B lymphocytes, macrophages and gliales13 cells. All this has led some authors to hypothesize that replication of HHV-6 in persistently infected tissues in certain susceptible individuals, it would cause an inflammatory response that lead to EM11,14. These results obtained so far have already led controversia15-18. The availability of drugs to prevent replication of HHV-619, which could be tested if confirmed the above hypothesis, has led us to make this consistent study to investigate using nested PCR for the presence of DNA of HHV-6 in liquid (CSF) in a number of patients diagnosed with MS-RR.

Patients and methods 23 patients, 17 women and 6 men are included, with a mean age at diagnosis of 28. 65 years and suffered from MS-RR, all of which are in phase outbreak at the time of sample collection. By lumbar puncture CSF extracted from each patient and is divided into two aliquots of 40-50 ul volume and stored at 70o C, without being previously centrifuged until the extraction technique and DNA amplification is performed. The patients included were subjected to no immunosuppressive treatment at the time of obtaining the samples studied. In 38. 09% of patients CSF belonged to the first outbreak of the disease, in a second outbreak 28. 57% to 33. 34% and in the third or later. Only patients who had their second or subsequent outbreaks had undergone treatment with bolus intravenous methylprednisolone. CSF control group of 23 patients who had undergone lumbar punctures to perform spinal anesthesia for surgery for peripheral vascular disease in the lower extremities was used, without any neurological disease present. In the samples studied nested PCR was performed 20 to detect DNA sequences of HHV-6. herpes simplex virus (HSV), Epstein-Barr virus (EBV), varicella zoster virus (VZV) and cytomegalovirus (CMV) infection: additionally also studied sequences.

In order to exclude false negative results, due to the existence of Taq polymerase inhibitors or formation of nonspecific banding between primers, an internal amplification control consisting of pseudorabies virus DNA (VPR) was included. Distilled water as negative control was used. As an initial step to carry out the PCR DNA was extracted from each of the samples to study, for which an enzymatic method, using as proteolytic enzyme 0. 5 . mu. l of proteinase K, 10 . mu. l of buffer used (50 mM KCl, 10 mM Tris-HCl pH 8. 3) and about 39. 5 . mu. l of each CSF sample. To perform the first amplification we prepared a mixture containing 42.

75 . mu. l of the following components: (10 mM Tris-HCl pH 8. 3), 50 mM KCl, 2 mM MgCl2, 0. 5 mM of each dNTP and 5 buffer pmol of each primer (5’GGTAATTTATGGTGATACGGA3 ‘and 5’TGTCTACCAATGTATCTTTTTTT3’). Plus 2 ul of internal amplification control (VPR DNA of 140 bp), 5 ul of negative control (sterile diluent), 0. 25 . mu. l of enzyme polymerization (Taq polymerase) and 5 . mu. l of the extracted DNA was added. In the second amplification employ 45 . mu.

l of a mixture containing buffer (60 mM Tris-HCl pH 8. 5), 15 mM (NH4) 2SO4, 2 mM MgCl2, 0. 5 mM of each dNTP and 10 pmol of each primer ( 5’GCCAAACATATCACAGATCG3 ‘and 5’ACATAAAATCTTTTCAAACTC3’) plus 0. 25 . mu. l of Taq polymerase and 0. 5 . mu. l of the obtained amplified in the first phase. Both amplifications were performed in a thermocycler (Touchdown Thermal Cycling System Hybaid) with 30 cycles of 15 sec: denaturation at 94 ° C, coupling at 53 ° C (first amplification) or 47 ° C (second amplification) and extension at 72 ° C, followed by a final extension cycle at 72 ° C for 6 minutes. Finally, 8 ml of each amplified product was subjected to agarose gel electrophoresis to 1. 2%. This process was completed, the gel dyed with 0.

5 . mu. l of ethidium bromide and moved to a transilluminator ultraviolet light allows us to visualize the presence of amplified DNA. PCR studies were performed blindly, without lab members might know what kind of patient samples corresponded to study. results By nested PCR technique applied to 23 CSF samples from patients with EM-RR phase of an outbreak, and an equal number of samples from patients without acute neurological disease, we have not detected DNA amplification of HHV-6 in any of they. Nor DNA amplification of the other agents studied was detected: VHS, EBV, CMV and VZV, none of the CSF samples studied (Fig. 1). Fig. 1. Detection DNA human herpesvirus 6 (HHV-6) in cerebrospinal fluid (CSF) of patients with multiple sclerosis (MS) by polymerase chain reaction (PCR) nested. herpes simplex virus (HSV) 120 base pairs, varicella zoster virus (VZV) 98 base pairs, cytomegalovirus (CMV) 78 pairs: at 1 marker molecular weight (Mw) of viral agents studied displayed bases, HHV-June 66 base pairs and Epstein-Barr virus (EBV) 54 base pairs. 2 corresponds to the negative control.

The streets from 3 to 8 correspond to PATIENT tes with relapsing-remitting type MS (RR-MS). no amplification band corresponding to the Pm studied, with the exception of internal control that is detected in all the streets and ensuring that there are no products that inhibit the reaction is not evidence. Discussion Despite our results, there is evidence that HHV-6 may play a pathogenic role in MS, as demonstrated by the ability to produce demyelination in other desmielinizantes7 diseases, the relationship between HHV-6 and associated EM11,12 the high degree of neuroinvasion the virus21 and its ability to remain latent and reactivated periódicamente8, all of which could explain even appreciated clinical exacerbations in MS. The mechanisms by which HHV-6 can cause MS may be multiple and complex. Thus, oligodendrocytes can be directly destroyed by the virus as demonstrated in cultures celulares22, although the small number of infected cells in MS compared to those observed in other HHV-Encephalitis 623. 24 suggests that other mechanisms must be charged. In this line the tumor necrosis factor (TNF) -alpha has been proposed as a mediator of demyelination cuantiosamente EM25 is produced by mononuclear cells in the infection HHV-626. 27, another pathogenic possibility is HHV-6 induction autoimmunity through cross between myelin antibodies and proteins of HHV-6, having demonstrated cross-reactivity between proteins of HHV-6 and mielina28 basic protein. The two works that in our view more evidence supporting the pathogenic role of HHV-6 in MS are those of Challoner11 and Knox12. Challoner et al, PCR in tissue and immunohistochemistry performed on brains from patients with MS, showing 80% of the studied brain samples nuclear staining for HHV-6 in oligodendrocytes, but in none of the brains group control11. The same authors, so even more interesting, this typical nuclear pattern shown in oligodendrocytes brain areas unaffected in four patients with MS, but none of the controls. Even so, there is also controversy in this field and although Jacobson et al 14 Challoner confirm the findings of other authors, 29,30 were unable to objectify these results with studies of similar design.

Knox et al, more recently, by immunohistochemistry also note of the fact cells with active infection in tissue from patients with MS in 73% of cases, contrary to what they observe in tissues of healthy people and other demyelinating diseases (13 %), and on the other hand the latter positive cases, leukoencephalitis caused by HHV-6. These authors, unlike Challoner et al, found no HHV-6 infection in unaffected tissue from patients with MS. Also first detected by immunohistochemistry presence of active infection HHV-6 (67%) lymph nodes from MS, and especially by culturing purified blood leukocyte cell medium objectify fibroblasts active infection HHV-6 in 54 % of MS patients compared to 0% in the control group, thus establishing a non-aggressive and fast method in which support future trials with antiviral MS. In MS patients have demonstrated high titers of antibodies against a variety of viruses possibly caused by desinmunorre-regulation observed in enfermedad31 own. That is why we do not set ourselves concomitant make our serology study to HHV-6. However, other authors do consider useful serologic studies and so Soldan et al 9 demonstrated an increase in IgM against early antigen of HHV-6 in 64% of sera from patients with EM-RR, lower than the percentage observed in sera from other neurological diseases and other inflammatory diseases, 21% and 19% respectively. They also perform serologic studies Sola et al32 and Wilborn et al 10 determining antibody titers against the virus in a group of MS patients obtaining higher titers of IgG in the group of patients with MS, which in the case of Sola et al achieved with respect to Control group statistical significance. Other authors, however, they uncover no this immune response and thus Nielsen et al33 when analyzing serum at different stages of MS and controls, there are quantitative differences in the levels of IgG against the virus among the groups studied. Applying the technique of PCR in serum samples, again obtained Soldan et al 9 DNA amplification of HHV-6 in 30% of MS patients compared to 0% in the control group. Other authors of our country applying the same technique in suero34 manage to amplify DNA in a much higher percentage (59. 6%) of serum samples from MS, obtaining, however, a high percentage also amplification in samples from group Control (39. 5%). However and as with serologic studies, two other groups of authors such as Fillet et al35 and Wilborn et al 10 achieved only amplify DNA of HHV-6 in a much lower percentage of sera from MS (6.

2% 0%, respectively). As for jobs similar to our design, in which we have tried to detect HHV-6 DNA in CSF of patients with MS-RR, et al 10 again Wilborn, without specifying the type of MS, they get amplified in 14. 3 % CSF of patients this virus; for this reason considered possible a pathogenic role of the virus in the development of the disease, despite not work study in their samples of CSF control group. Different autores34 who have obtained much lower percentages (around 6%) of amplified DNA in CSF of MS patients come to the same conclusion. Other published studies show opposite to the above findings, failing to detect viral DNA in any of the CSF samples analizadas16, or conversely, objectified presence of DNA of HHV-6 in a high percentage of CSF of MS, but also in the control36 group. We believe that our work but does not show the presence of HHV-6 in CSF does not rule at all that this virus plays a role in the pathogenesis of MS as in PML, caused by the JC virus, which PCR CSF virus is detected only 80% of pacientes37. New studies in line Challoner et al 11 and especially Knox et al 12 are essential to clarify the relationship between HHV-6 and MS.

Molluscum contagiosum

Molluscum contagiosum is a skin infection with pearl appearance, very easy to spread. One of its modes of transmission is through sexual contact, so it has been included in the group of sexually transmitted diseases. Definition It is a benign skin tumor that affects only humans, caused by a virus of the genus Molluscipoxvirus. Causes Infection occurs when there is direct contact with exposed skin injury. When is transmitted by sexual contact injuries genitals can be confused with warts or herpes, however, lesions of molluscum painless. It is common also find it by direct contact transmission face, neck, armpits, arms and hands, almost anywhere in the body except palms or soles of the feet. It is common in preschool children. The virus can also spread through contact with contaminated objects such as towels, clothing, toys, etc. It is frequently found in patients with compromised defenses or low, as in the case of AIDS patients. Epidemiology It is increasingly common to find as sexually-transmitted disease in young adults.

It’s commonly found in AIDS patients, which sometimes may have abundant Molluscum lesions on the skin. The disease is found worldwide, currently remains more common in children than in adults. symptoms After infection, it can take up to 6 months to present injuries. The lesion begins as a small lump or 2 to 5 millimeters in diameter, which is not painful ball, but can cause itching, and can grow to become a flesh-colored lump-like pearl. Typically these tumors have a dimple (or navel) in the center. Scratching causes the spread of viruses on the skin and the appearance of more lesions, which are sometimes observed in rows or groups. The lesions may persist for up to two years, but eventually retire spontaneously. Not often redden or appear inflamed, unless scratching the person wounds cause skin which is subsequently infected. Diagnosis The doctor will diagnose molluscum contagiosum based on the appearance of the lesions and can confirm by a biopsy of the skin in the affected area. The injury should always be evaluated by a physician to rule out other problems. The doctor can squeeze the contents of injuries and in some cases use it for laboratory diagnosis.


Treatment Individual lesions can be removed by scraping, removal of the nucleus, freezing or electrosurgery. These procedures are performed by an expert dermatologist mode outpatient surgery. In most people the disease goes away by itself in less than two years. Prevention In the case of sexual transmission, condom in this case is not entirely effective, as the person may have lesions in areas not covered by the condom. It is best to have sex with a mutually monogamous and informed partner. The spread in other areas of the skin and especially in children is prevented by avoiding direct contact with skin lesions and not sharing towels with others. Forecast Only injuries were scratches can leave marks in that area of ​​the skin. They usually disappear between 2 months and 2 years. They can persist in people with AIDS and other diseases that cause engagement of immune system defenses. Specialist in the diagnosis, treatment and control

The general practitioner will diagnose reviewing injuries and may be supported by an evaluation by a dermatologist. A dermatologist can perform the removal of lesions with the above methods. CONCLUSION: Molluscum is a skin disease transmitted by a virus. Each time is more transmission by sexual contact. It resolves itself in an approximate two-year course. People with AIDS may persist with injuries for longer periods of time. BIBLIOGRAPHIC REFERENCES: Poxvirus. Jawetz Medical Microbiology, Melnick and Adelberg. 17th edition in Spanish. Sexually transmitted diseases. National Library of Medicine.

http://www. nlm. nih. gov/ Pathology of the lower genital tract in women. Dra. Guadalupe Villanueva Quintero. Gynecology. Dr. Luis Armando González Gutiérrez. University of Guadalajara. Ed. 2005, pp: 111-113

Article owned by Doctor Universe Written by Dr. Jose de Jesus Perez Summer Surgeon and Obstetrician Professional Certificate 105076 Senior Medical Doctor Universe www. universomedico. com. mx

Stomatologic complications in HIV positive patients: Clinical Correlations

Original work:  Stomatologic complications in HIV positive patients: CLINICAL CORRELATIONS – DEMOGRAPHIC AND LABORATORY HOME> PUBLICATIONS> Volume 50 No. 1/2012> Received for arbitration: 09/03/2010 Accepted for publication: 26/01/2011 Flávio Domingos Saldanha PACHECO: Student Course Master of Oral Pathology, Graduate Program in Oral Pathology, Federal University of Rio Grande do Norte – UFRN, Natal / RN, Brazil. Manuel Antonio GORDÓN-NÚÑEZ: M. D. , Ph. D. Oral Pathology em, do Visiting Professor Department of Dentistry, Federal University of Rio Grande do Norte / Graduate Program in Oral Pathology – UFRN, Natal / RN, Brazil. Leonardo Miguel Madeira SILVA: Student of Dentistry, Department of Dentistry, Federal University of Rio Grande do Norte, Natal / RN, Brazil.

Giovani Kléber LIGHT: do Professor Department of Infectious Diseases, Federal University of Rio Grande do Norte, Natal / RN, Brazil. Cavalcanti Hébel GALVÃO: M. D. , Ph. D. Oral Pathology, Associate Professor II, Graduate Program in Oral Pathology, Federal University of Rio Grande do Norte – UFRN, Natal / RN, Brazil. Mailing address Hébel Cavalcanti Galvão Avenida Senador Salgado Filho, 1787. Lagoa Nova, Natal / RN, Brazil. CEP 59056-000 Tele / fax: + 55-84-3215-4138; E-mail: hebel. galvao@yahoo.

com. br / gordonnunez28@yahoo. com DENTAL COMPLICATIONS IN HIV POSITIVE PATIENTS: CLINICAL CORRELATIONS – DEMOGRAPHIC AND LABORATORY ABSTRACT The stomatologic complications are due to HIV infection, a lot of times, the first clinical signs of the disease. These injuries May Also function as beepers and sentries of the curse and progression of the HIV infection and AIDS. The objective of This work was to Evaluate the prevalence of the oral injuries in HIV positive Patients from the Hospital of Infected contagious Gizelda Trigueiro in Natal-RN, Brazil, and correlate them With demographic factors: such as gender, age, form of HIV infection and immune status (CD4 + T cells). CD4, According to the criteria of EC-CLEARINGHOUSE / WHO, through clinical oral examination and T + cell count 121 Patients Were EVALUATED. The oral candidiasis was The most common lesion (45. 2%), followed by oral hairy leukoplakia (16. 1%), linear gingival erythema (16. 1%), lips herpes (12.

9%), necrotizing periodontitis (6. 5%) and necrotizing gingivitis (3. 2% ) Predominantly occurring in men Between the ages 30 to 44 years, WHO HIV infection acquired through sexual contact. Based on the results of esta study, Concluded That there was a prevalence of the stomatologic complications profile That Is Commonly Reported in the literature. These Changes Were Associated with a decrease in the number of CD4 + T cells, Representing markers of the infection progression and / or failure of HAART, so a thorough oral examination is Important in clinical evaluation and follow up of Patients With HIV. Key Words: HIV, oral lesions, AIDS. Stomatologic complications in HIV positive patients: CLINICAL CORRELATIONS – DEMOGRAPHIC AND LABORATORY SUMMARY The (EC) stomatological complications in HIV + patients are often the first clinical signs of the disease and can function as signaling the course and progression of HIV infection and AIDS. This study assessed the prevalence of HIV + patients oral lesions ee Hospital Infectious Diseases Gizelda Trigueiro, in Natal-RN, Brazil and correlate with socio-demographic factors such as gender, age, mode of transmission and immune status. According to the criteria of the EC-CLEARINGHOUSE / WHO, through oral clinical examination and counting of CD4 + T cells were evaluated 121 HIV + patients. The most frequent injuries were candidiasis (45. 2%), hairy leukoplakia (16.

1%), erythema gingival linear (16. 1%), cold sores (12. 9%), necrotizing periodontitis (6. 5%) and necrotizing (3. 2%) gingivitis, occurring more often in men between the ages of 30-44 years who acquired HIV through sexual contact. Based on the results of this study conclude that there was a prevalence of stomatological profile complications commonly reported in the literature. The lesions were associated with reducing the number of CD4 + cells, representing, therefore markers of the progression of virus infection and / or failure of HAART, if so, a comprehensive oral examination is important in the clinical evaluation and support for HIV patients. Keywords: oral lesions HIV, AIDS. INTRODUCTION The Acquired Immune Deficiency Syndrome, known worldwide as AIDS was first described in 1981 in the United States, gay men, who had in common a significant reduction in the cellular immune response. Currently considered a serious pandemic, AIDS is the advanced clinical manifestation of HIV infection in January. The main cause of the progression of AIDS in HIV-infected patients is-1 reduction of CD4 + T cells, responsible for the specific humoral immune response and cell mediated. With the commitment of the infected individual’s immune system becomes susceptible to opportunistic infections and other diseases that can lead to death in February.

Factors that predispose to the emergence of HIV related oral lesions include the number of CD4 + T cells less than 200 cells / mm3 and levels of HIV RNA in plasma greater than 300 copies / ul, besides the presence of xerostomia, oral hygiene 3. 4 poor and smoking. With the introduction of highly active antiretroviral therapy (HAART) has been observed considerable control of viral replication and reconstituting immune functions in patients with immunodeficiency induced by HIV, consequently, there was a significant reduction in late complications of that infection, including death, allowing greater survival in May. Studies of the prevalence of oral lesions associated with HIV has shown wide variations in different countries 6. The emergence of HAART has changed the profile prevalence of lesions were more frequent before in patients living with HIV. 7-10 In recent work, oral lesions associated with human papillomavirus (HPV) and salivary gland diseases related to HIV have been targeted as the most prevalent in HIV + patients 7,8,11. The importance of knowledge of the oral manifestations in HIV positive patients is that these demonstrations may often emerge as first clinical sign or teaching 12,13 Since the first descriptions, oral manifestations have assumed an important role because of its diagnostic and predictive value for the evaluation and disease progression 14. Thanks to new therapies, the prevalence of demonstrations that were more obvious, such as Kaposi’s sarcoma and hairy leukoplakia has been reduced dramatically. 14-16 Approximately 60% of HIV-infected individuals and 80% of AIDS have undertaken stomatology demonstrations. Oral candidiasis and hairy leukoplakia are considered important clinical indicators of the progression of HIV infection to AIDS box, mainly in places where specific tests are not performed. These lesions, along with Kaposi’s sarcoma, non-Hodgkin lymphoma, linear gingival erythema, necrotizing gingivitis and necrotizing periodontitis, are considered strongly associated with HIV infection 17.

The large number of stomatological complications reported in the literature on the importance alert to routine conducting thorough clinical examination of the oral cavity and on the definition of behaviors related to treatment and oral health promotion. They have high predictive value in assessing progression of AIDS 18. Based on the above, this study presents a quantitative analysis of the prevalence of most of oral complications, relating to socio-demographic factors such as gender, age, race, mode of transmission and time of antiretroviral therapy in HIV-positive patients with / or without AIDS treated at the Hospital of Infectious Diseases Gizelda Trigueiro in Natal / RN, Brazil, seeking to trace the profile of these manifestations in this population, aiming to contribute to the establishment of the main marker lesions disease progression and get information to develop preventive and enable more effective management protocols. MATERIALS AND METHODS Through this prospective descriptive epidemiological study were evaluated HIV-infected with laboratory results confirmed through ELISA and Western Blot tests and accompanied clinically in the outpatient sector Hospital of Infectious Diseases Giselda Trigueiro adult patients – HEIGT in Natal – RN / Brazil. Under strict biosecurity measures, by visual inspection and digital palpation, all patients underwent a thorough clinical examination of oral and perioral structures, made by two trained examiners and calibrated, following the diagnostic criteria and classification recommended by the EC-CLEARINGHOUSE / WHO (1993). The patients answered a questionnaire on demographics, such as gender, age, medical history, previous and current, as well as previous and current therapies, the form of HIV infection and immune status (CD4 + cells). We quantified the CD4 + T cells, by flow cytometry using monoclonal antibodies, with test reagents CD4 FACSCount BD (BD Biosciences), whose reading was made with the equipment FACounts BD (Becton Dickinson). The blood collection for laboratory tests was performed immediately after the completion of the oral examination, within a maximum period of 4 hours, in order to establish the number of CD4 + lymphocytes of the individual at the time of the oral exam. Taking into consideration the count of CD4 + T cells, the immune status of patients was classified into mild immunosuppression (> 500 cells / mm3); moderate immunosuppression (> 200 –

vulva Disorders

By Dr Ananya Mandal, MD There are Several disorders of the female reproductive system. Some of These are confined to the external female reproductive organs like the vulva. Gynaecologists Deal with the diagnosis and treatment of the diseases and disorders Associated With the female reproductive organs. Most women need to Have Regular examination of Their vulva by self or by a gynecologist to detect any abnormalities. There are Several disorders That May lead to abnormalities in appearance of the vulva. These are classified as: Causes of rashes, eruptions and plaques over the vulva: Contact dermatitis – These are allergic reactions That May be Caused due to dyed or perfumed toilet tissues, underwear, soaps, detergents, fabric softeners, talcum powder, hygiene sprays, spermicidal foams, creams, tablets, diaphragms etc. vulvar eczema Infection due to Candida and yeast, jock itch etc. Lichen simplex chronicus – Leads to symmetric, pigmentation, leathery, or coarse texture Lichen sclerosus – Leads to plae patches and loss of elasticity


Lichen planus Psoriasis – There are pink plaques Causes of ulcers in the vulva Vulvar cancer – squamous cell Of Including types, basal cell carcinoma and melanoma With Infections Herpes simplex, Epstein-Barr virus Behcet’s, cicatricial pemphigoid ulcers aphthous ulcers Pyoderma gangrenosum, anorectal ulcers, Crohn’s ulcers Ulcers due to Syphilis, lymphogranuloma venereum, chancroid, donovonosis Ulcers due to trauma or decubitus ulcers and friction called traumatic ulcers Pemphigus vulgaris and Pemphigoid (mucous membrane pemphigoid, cicratricial pemphigoid, bullous pemphigoid) Causes of lumps, cysts, nodules Tumours and over the vulva – epidermal cysts

Condyloma acuminatum due to infectious, molluscum contagiosum Swelling of Apocrine and eccrine gland Including hidradenoma, Fox-Fordyce, syringoma Swelling of the epidermal inclusion cyst Keratinocytes Including, angiokeratoma, seborrheic keratosis Swelling after trauma – posttraumatic hematoma Swellings of mesenchymal origin Including – lipoma, leiomyoma, fi joke, granular cell myoblastoma Which swellings and lumps are embryological remnants Including mucocele, mesonepthic duct cyst, Bartholin cyst, Canal of Nuck cyst of. Other conditions include congenital septate vagina, imperforate hymen, hermaphroditism etc. Other minor facial swellings Including adenoma, hemangioma and vulvar varicosities Causes of blemishes moles Freckles Scars, Lentigos Tattoos

vitiligo patches hypertrophy Causes of vulvodynia or vulval pain Vulvular vulvodynia and vestibulitis vaginismus Reviewed by April Cashin-Garbutt, BA Hons (Cantab) Further Reading

EBSCO

Diseases : Related terms • Cold Sores; Genital herpes Principal Proposed Natural Treatments • Aloe vera (treatment); L-Lysine (Prevention); Melissa (Prevention and Treatment); Zinc T peak (Treatment) Other Proposed Natural Treatments • Astrgalo; Propleo Bee; Jack Ua; Berry Saco; Eleuterococo; Kelp; Salvia cream / rhubarb; I Sandalwood; T oil tree; Vitamin C Treatments Probably Not Effective • Equincea The common virus known as herpes can cause painful lesions similar to a mpula around the mouth and genitals. slightly different strains of herpes predominate in each of two locations, but infections are essentially idnticas. In both areas, the herpes virus has the devious habit of hiding out deep in the DNA of nerve ganglia, where it remains dormant for months or years. Occasionally the virus reactivates, it travels along the nerves and initiates an eruption.

Common triggers include stress, dental procedures, infections and trauma. Outbreaks usually become less severe over time. Conventional medical treatment consists of antiviral drugs, such as Zovirax. These drugs can reduce the duration and severity of an outbreak of herpes or when administered consistently in low doses, reduce the frequency of outbreaks. In addition, they can reduce transmission of the disease. Principal Proposed Natural Treatments Several natural treatments have shown promise for treating herpes. However, note that while conventional treatments can reduce infectivity and thereby help prevent the proliferation of the disease, has not been shown that natural treatment sb do this. Keep in mind that common sense methods used to prevent herpes transmission are not completely effective: Many people are infected even though no obvious symptoms and use of the condom does not completely prevent the proliferation of the virus. Therefore, if you are sexually active with an uninfected partner who wishes to sindolo, we strongly recommend that you use a suppressive drug therapy. Melissa officinalis (Melissa) More commonly known in the United States as lemon balm, Melissa officinalis is widely sold in Europe as a tpica cream for the treatment of genital and oral herpes. A double-blind placebo-controlled analiz 66 people who were beginning to develop cold sores (oral herpes).

4 Treatment with melissa cream produced significant benefits on the second day, reducing intensity of discomfort, number of blisters and the size of the lesin. (Specifically the researchers observed in the second day because it according them, is when the symptoms are more marked. ) Another double-blind study of 116 individuals with analiz oral or genital herpes. 3 Participants used either melissa cream or placebo cream for up to 10 days. The results showed that the use of the herb resulted in an index of recovery significantly better than those that were administr placebo. For more information, including dosage and safety issues, see the full article on melissa. Aloe vera The succulent aloe plant is famous as a treatment for burns and minor injuries. However, although there is little evidence that it is effective for those propsitos, two studies suggest that aloe has potential value in the treatment of herpes infections. A clnico double-blind placebo-controlled two weeks enlist 60 men with active genital herpes. 7 Participants applied aloe cream (0. 5% aloe) or placebo cream three times a day for five days.

The use of aloe cream reduced the time required for lesions to heal and also Aument the percentage of individuals who were fully healed at the end of 2 weeks. A previous double blind placebo controlled by the same author who enlist 120 men with genital herpes Met that aloe cream was more effective than pure aloe gel or placebo. 8 teoriz author fatty components in the cream improved aloe absorption. For more information, including dosage and safety issues, see the full article on aloe. L-Lysine Another famous treatment for herpes include aminocido L-lysine. Taken regularly in sufficient doses, it appears that lysine supplements reduce the number and intensity of herpes outbreaks. 9 However, a study that evaluates the lysine administered only at the beginning of an attack of herpes NOT FOUND benefits. 10 (Consider using melissa for this latter purpose. ) A double-blind placebo-controlled analiz to 52 participants with a history clnico herpes outbreaks. 11 While receiving 3 g of L-lysine every day for 6 months, the treatment group experiment an average of 2. 4 fewer herpes outbreaks than the placebo group; a significant difference.

Outbreaks lysine group also were less severe and healed significantly faster. Another double-blind crossover study of placebo-controlled study in 41 subjects Met also improvements in the frequency of attacks. 12 Interestingly, this study found that 1,250 mg of lysine daily worked, but 624 mg not they were doing it. Other studies, including one that analiz to 65 individuals, Met benefits, but they used lower dosages of lysine. 13, 14 For more information, including dosage and safety issues, see the full article on lysine. Zinc It is believed that the pills or nasal sprays of zinc are effective against the viruses that cause colds. A recent study suggests that the typical zinc may also be useful for herpes infections of the mouth and face. Clnico In this trial, 46 individuals with cold sores were treated with a zinc oxide cream or placebo every 2 hours until cold sores cedi. 17 The results showed that individuals using the cream experienced a reduction in the severity of symptoms and shortest period for complete recovery. Other Proposed Natural Treatments Eleutherococcus, incorrectly called Russian or Siberian ginseng, has shown promise for treating herpes.

A double-blind trial clnico 6 months in 93 men and women with recurrent genital herpes infections Met that treatment with Eleutherococcus (2 g a day) Reduca the frequency of infections by almost 50%. 18 A clnico double-blind trial of 149 individuals with recurrent oral herpes compar the effectiveness of Zovirax cream Contain Contain cream with herbs sage and rhubarb, and cream Contain sage alone. 26 The combination of sage and rhubarb DEMO be equally effective as Zovirax cream and possibly more effective than single sage. One study suggests that the typical treatment with a solution of vitamin C can accelerate curacin of oral herpes outbreaks. 19 Vitamin C with bioflavonoids combined oral has also shown some promise for genital herpes. twenty The results of a small single-blind controlled study suggests that the honeybee product propolis cream may cause attacks of genital herpes to heal faster. twenty-one Sometimes other herbs and supplements for herpes infections are recommended, but the absence of meaningful supporting evidence, including astrgalo, ua cat, sack berry, kelp, 22sndalo, 23 and oil tree t. 25 A product containing vitamins and minerals as well as the herbs paprika, rosemary, yarrow, buckthorn and pumpkin seed has been used in Scandinavia for many years as a treatment for various mouth-related diseases. However, a double-blind study of 50 people with recurrent oral herpes did not manage to find a treatment for 4 months with this product more effective than placebo.

27 Also, a double-blind placebo-controlled trial of 1 year 50 individuals with recurrent genital herpes did not manage to find the grass equincea useful to reduce the index of outbreaks. 24 References 1. Wölbling RH, Leonhardt K. Local therapy of herpes simplex with dried extract from Melissa officinalis. Phytomedicine. 1994; 1: 25-31. 2. Wölbling RH, Leonhardt K. Local therapy of herpes simplex with dried extract from Melissa officinalis. Phytomedicine.

1994; 1: 25-31. 3. Wölbling RH, Leonhardt K. Local therapy of herpes simplex with dried extract from Melissa officinalis. Phytomedicine. 1994; 1: 25-31. 4. Koytchev R, Alken RG, Dundarov S. Balm mint extract (I-701) for topical treatment of Herpes labialis recurring. Phytomedicine. 1999; 6: 225-230. 5. Wölbling RH, Leonhardt K.

Local therapy of herpes simplex with dried extract from Melissa officinalis. Phytomedicine. 1994; 1: 25-31. 7. Syed TA, Afzal M, Ashfaq Ahmad S, et al. Management of genital herpes in men with 0. 5% Aloe vera extract in a hydrophilic cream: a placebo-controlled double-blind study. J Dermatol Treat. 1997; 8: 99-102. 8. Syed TA, Cheema KM, Ashfaq A, et al. Aloe vera estract 0. 5% in ahydrophilic cream Aloe vera gel versus for the management of genital herpes in evils.

A placebo-controlled, double-blind, comparative study [letter]. J Eur Acad Dermatol Venereol. 1996; 7: 294-295. 9. Flodin NW. The metabolic roles, pharmacology, and toxicology of lysine. J Am Coll Nutr. 1997; 16: 7-21. 10. Milman N, J Scheibel, O. Jessen Failure of lysine treatment in recurrent herpes simplex labialis [letter]. Lancet. 1978; 2: 942.

11. Griffith RS, Walsh, Myrmel KH, et al. Success of L -lysine therapy in recurrent herpes simplex infection faq frequently: treatment and prophylaxis. Dermatologica. 1987; 175: 183-190. 12. McCune MA, Perry HO, Muller SA, et al. Treatment of recurrent herpes simplex infections with L-lysine monohydrochloride. Cutis. 1984; 34: 366-373. 13. DiGiovanna JJ, Blank H. Failure of lysine in herpes simplex faq frequently recurrent infection.

Treatment and prophylaxis. Arch Dermatol. 1984; 120: 48-51. 14. Milman N, J Scheibel, O. Jessen Lysine prophylaxis in recurrent herpes simplex labialis: a double-blind, controlled crossover study. Acta Derm Venereol. 1980; 60: 85-87. 17. Godfrey HR, NJ Godfrey, Godfrey JC, et al. A randomized clinical trial on the treatment of oral herpes With topical zinc oxide / glycine. Altern Ther Health Med. 2001; 7: 49 – 54, 56.

18. M. Williams Immuno-Protection against herpes simplex type II infection by Eleutherococcus root extract. Int J Med Alt Complement 1995; 13: 9-12. . 19. Hovi T, Hirvimies A, Stenvik M, et al. Topical treatment of recurrent mucocutaneous herpes With ascorbic acid-containing solution. Antiviral Res. 1995; 27: 263-270. 20. Terezhalmy GT, Bottomley WK, Pelleu GB. The use of water-soluble bioflavonoid-ascorbic acid complex in the treatment of recurrent herpes labialis.

Oral Surg Oral Med Oral Pathol. 1978; 45: 56-62. 21. Vynograd N, Vynograd I, Sosnowski Z. A comparative multi-center study of the efficacy of propolis, acyclovir and placebo in the treatment of genital herpes. Phytomedicine. 2000; 7: 1-6. 22. Carlucci MJ, Ciancia M, Matulewicz MC, et al. Antiherpetic activity and mode of action of the natural carrageenans of diverse structural types. Antiviral Res. 1999; 43: 93-102. 23.

Benencia F, Courreges MC. Antiviral activity of sandalwood oil Against Herpes simplex viruses 1 and -2-. Phytomedicine. 1999; 6: 119-123. 24. Vonau B, S Chard, Mandalia S, et al. Does the extract of the plant Echinacea purpurea influence the clinical course of recurrent genital herpes? Int J STD AIDS. 2001; 12: 154-158. 25. Carson CF, Ashton L, Dry L, et al. melaleuca alternifolia (tea tree) oil gel (6%) for the treatment of recurrent herpes labialis. J Antimicrob Chemother.

2001; 48: 450-451. 26. Saller R, S Buechi, Meyrat R, et al. Combined herbal preparation for topical treatment of herpes labialis. Forsch Komplementarmed Naturheilkd Klass. 2001; 8: 373-382. 27. A. Pedersen and herpes labialis LongoVital: a randomized, double-blind, placebo-controlled study. Oral Dis. 2001; 7: 221-225. Last reviewed August 2013 by EBSCO CAM Review Board Please be aware esta That information is provided to supplement the care provided by your physician.

It is neither implied nor Intended to be a substitute for professional medical advice. CALL YOUR HEALTHCARE PROVIDER IMMEDIATELY IF YOU THINK YOU MAY HAVE A MEDICAL EMERGENCY. Always seek the advice of your physician or other qualified health provider prior to starting any new treatment or With any questions you May Have Regarding a medical condition. Copyright (C) 2011 EBSCO Publishing. All rights reserved. Back to Top