Absence of human herpesvirus 6 DNA in CSF by nested PCR in patients with multiple

Introduction Always it has been suspected that viruses may play an important role in the pathogenesis of multiple sclerosis (MS) 1. Attempts have been attributed to some of them, so far unsuccessfully, as triggers the autoimmune response that leads to desmielinización2-6 plates. What one has established it is that certain viruses are causative agents four demyelinating diseases: progressive multifocal leukoencephalopathy (JC virus), post-infectious encephalitis (measles), encephalopathy human immunodeficiency virus (HIV) and myelopathy HIV. 7. As recently described attributable to human herpesvirus type 6 (HHV-6) in different pathologies pathogenetic role, highlighted in neurological diseases references associating it with EM8. In this regard they have shown higher antibody titers against HHV-6 in MS in controles9,10. It has also been detected by polymerase chain reaction (PCR) DNA of HHV-6 in serum mainly patients with MS type relapsing-remitting (EM-RR), unlike controles9 and by immunohistochemistry has been objectified HVH -6 in oligodendrocytes from areas of demyelination but also areas of apparently healthy white matter of patients who died with EM11. Very recently he turned to objectify by immunohistochemistry HHV-6 in MS white matter affected, but also in lymphoid tissue and by culture in peripheral blood leukocytes from these patients12. On the other hand, we know that the HHV-6 virus is cytopathic for CD4 + T lymphocytes, B lymphocytes, macrophages and gliales13 cells. All this has led some authors to hypothesize that replication of HHV-6 in persistently infected tissues in certain susceptible individuals, it would cause an inflammatory response that lead to EM11,14. These results obtained so far have already led controversia15-18. The availability of drugs to prevent replication of HHV-619, which could be tested if confirmed the above hypothesis, has led us to make this consistent study to investigate using nested PCR for the presence of DNA of HHV-6 in liquid (CSF) in a number of patients diagnosed with MS-RR.

Patients and methods 23 patients, 17 women and 6 men are included, with a mean age at diagnosis of 28. 65 years and suffered from MS-RR, all of which are in phase outbreak at the time of sample collection. By lumbar puncture CSF extracted from each patient and is divided into two aliquots of 40-50 ul volume and stored at 70o C, without being previously centrifuged until the extraction technique and DNA amplification is performed. The patients included were subjected to no immunosuppressive treatment at the time of obtaining the samples studied. In 38. 09% of patients CSF belonged to the first outbreak of the disease, in a second outbreak 28. 57% to 33. 34% and in the third or later. Only patients who had their second or subsequent outbreaks had undergone treatment with bolus intravenous methylprednisolone. CSF control group of 23 patients who had undergone lumbar punctures to perform spinal anesthesia for surgery for peripheral vascular disease in the lower extremities was used, without any neurological disease present. In the samples studied nested PCR was performed 20 to detect DNA sequences of HHV-6. herpes simplex virus (HSV), Epstein-Barr virus (EBV), varicella zoster virus (VZV) and cytomegalovirus (CMV) infection: additionally also studied sequences.

In order to exclude false negative results, due to the existence of Taq polymerase inhibitors or formation of nonspecific banding between primers, an internal amplification control consisting of pseudorabies virus DNA (VPR) was included. Distilled water as negative control was used. As an initial step to carry out the PCR DNA was extracted from each of the samples to study, for which an enzymatic method, using as proteolytic enzyme 0. 5 . mu. l of proteinase K, 10 . mu. l of buffer used (50 mM KCl, 10 mM Tris-HCl pH 8. 3) and about 39. 5 . mu. l of each CSF sample. To perform the first amplification we prepared a mixture containing 42.

75 . mu. l of the following components: (10 mM Tris-HCl pH 8. 3), 50 mM KCl, 2 mM MgCl2, 0. 5 mM of each dNTP and 5 buffer pmol of each primer (5’GGTAATTTATGGTGATACGGA3 ‘and 5’TGTCTACCAATGTATCTTTTTTT3’). Plus 2 ul of internal amplification control (VPR DNA of 140 bp), 5 ul of negative control (sterile diluent), 0. 25 . mu. l of enzyme polymerization (Taq polymerase) and 5 . mu. l of the extracted DNA was added. In the second amplification employ 45 . mu.

l of a mixture containing buffer (60 mM Tris-HCl pH 8. 5), 15 mM (NH4) 2SO4, 2 mM MgCl2, 0. 5 mM of each dNTP and 10 pmol of each primer ( 5’GCCAAACATATCACAGATCG3 ‘and 5’ACATAAAATCTTTTCAAACTC3’) plus 0. 25 . mu. l of Taq polymerase and 0. 5 . mu. l of the obtained amplified in the first phase. Both amplifications were performed in a thermocycler (Touchdown Thermal Cycling System Hybaid) with 30 cycles of 15 sec: denaturation at 94 ° C, coupling at 53 ° C (first amplification) or 47 ° C (second amplification) and extension at 72 ° C, followed by a final extension cycle at 72 ° C for 6 minutes. Finally, 8 ml of each amplified product was subjected to agarose gel electrophoresis to 1. 2%. This process was completed, the gel dyed with 0.

5 . mu. l of ethidium bromide and moved to a transilluminator ultraviolet light allows us to visualize the presence of amplified DNA. PCR studies were performed blindly, without lab members might know what kind of patient samples corresponded to study. results By nested PCR technique applied to 23 CSF samples from patients with EM-RR phase of an outbreak, and an equal number of samples from patients without acute neurological disease, we have not detected DNA amplification of HHV-6 in any of they. Nor DNA amplification of the other agents studied was detected: VHS, EBV, CMV and VZV, none of the CSF samples studied (Fig. 1). Fig. 1. Detection DNA human herpesvirus 6 (HHV-6) in cerebrospinal fluid (CSF) of patients with multiple sclerosis (MS) by polymerase chain reaction (PCR) nested. herpes simplex virus (HSV) 120 base pairs, varicella zoster virus (VZV) 98 base pairs, cytomegalovirus (CMV) 78 pairs: at 1 marker molecular weight (Mw) of viral agents studied displayed bases, HHV-June 66 base pairs and Epstein-Barr virus (EBV) 54 base pairs. 2 corresponds to the negative control.

The streets from 3 to 8 correspond to PATIENT tes with relapsing-remitting type MS (RR-MS). no amplification band corresponding to the Pm studied, with the exception of internal control that is detected in all the streets and ensuring that there are no products that inhibit the reaction is not evidence. Discussion Despite our results, there is evidence that HHV-6 may play a pathogenic role in MS, as demonstrated by the ability to produce demyelination in other desmielinizantes7 diseases, the relationship between HHV-6 and associated EM11,12 the high degree of neuroinvasion the virus21 and its ability to remain latent and reactivated periódicamente8, all of which could explain even appreciated clinical exacerbations in MS. The mechanisms by which HHV-6 can cause MS may be multiple and complex. Thus, oligodendrocytes can be directly destroyed by the virus as demonstrated in cultures celulares22, although the small number of infected cells in MS compared to those observed in other HHV-Encephalitis 623. 24 suggests that other mechanisms must be charged. In this line the tumor necrosis factor (TNF) -alpha has been proposed as a mediator of demyelination cuantiosamente EM25 is produced by mononuclear cells in the infection HHV-626. 27, another pathogenic possibility is HHV-6 induction autoimmunity through cross between myelin antibodies and proteins of HHV-6, having demonstrated cross-reactivity between proteins of HHV-6 and mielina28 basic protein. The two works that in our view more evidence supporting the pathogenic role of HHV-6 in MS are those of Challoner11 and Knox12. Challoner et al, PCR in tissue and immunohistochemistry performed on brains from patients with MS, showing 80% of the studied brain samples nuclear staining for HHV-6 in oligodendrocytes, but in none of the brains group control11. The same authors, so even more interesting, this typical nuclear pattern shown in oligodendrocytes brain areas unaffected in four patients with MS, but none of the controls. Even so, there is also controversy in this field and although Jacobson et al 14 Challoner confirm the findings of other authors, 29,30 were unable to objectify these results with studies of similar design.

Knox et al, more recently, by immunohistochemistry also note of the fact cells with active infection in tissue from patients with MS in 73% of cases, contrary to what they observe in tissues of healthy people and other demyelinating diseases (13 %), and on the other hand the latter positive cases, leukoencephalitis caused by HHV-6. These authors, unlike Challoner et al, found no HHV-6 infection in unaffected tissue from patients with MS. Also first detected by immunohistochemistry presence of active infection HHV-6 (67%) lymph nodes from MS, and especially by culturing purified blood leukocyte cell medium objectify fibroblasts active infection HHV-6 in 54 % of MS patients compared to 0% in the control group, thus establishing a non-aggressive and fast method in which support future trials with antiviral MS. In MS patients have demonstrated high titers of antibodies against a variety of viruses possibly caused by desinmunorre-regulation observed in enfermedad31 own. That is why we do not set ourselves concomitant make our serology study to HHV-6. However, other authors do consider useful serologic studies and so Soldan et al 9 demonstrated an increase in IgM against early antigen of HHV-6 in 64% of sera from patients with EM-RR, lower than the percentage observed in sera from other neurological diseases and other inflammatory diseases, 21% and 19% respectively. They also perform serologic studies Sola et al32 and Wilborn et al 10 determining antibody titers against the virus in a group of MS patients obtaining higher titers of IgG in the group of patients with MS, which in the case of Sola et al achieved with respect to Control group statistical significance. Other authors, however, they uncover no this immune response and thus Nielsen et al33 when analyzing serum at different stages of MS and controls, there are quantitative differences in the levels of IgG against the virus among the groups studied. Applying the technique of PCR in serum samples, again obtained Soldan et al 9 DNA amplification of HHV-6 in 30% of MS patients compared to 0% in the control group. Other authors of our country applying the same technique in suero34 manage to amplify DNA in a much higher percentage (59. 6%) of serum samples from MS, obtaining, however, a high percentage also amplification in samples from group Control (39. 5%). However and as with serologic studies, two other groups of authors such as Fillet et al35 and Wilborn et al 10 achieved only amplify DNA of HHV-6 in a much lower percentage of sera from MS (6.

2% 0%, respectively). As for jobs similar to our design, in which we have tried to detect HHV-6 DNA in CSF of patients with MS-RR, et al 10 again Wilborn, without specifying the type of MS, they get amplified in 14. 3 % CSF of patients this virus; for this reason considered possible a pathogenic role of the virus in the development of the disease, despite not work study in their samples of CSF control group. Different autores34 who have obtained much lower percentages (around 6%) of amplified DNA in CSF of MS patients come to the same conclusion. Other published studies show opposite to the above findings, failing to detect viral DNA in any of the CSF samples analizadas16, or conversely, objectified presence of DNA of HHV-6 in a high percentage of CSF of MS, but also in the control36 group. We believe that our work but does not show the presence of HHV-6 in CSF does not rule at all that this virus plays a role in the pathogenesis of MS as in PML, caused by the JC virus, which PCR CSF virus is detected only 80% of pacientes37. New studies in line Challoner et al 11 and especially Knox et al 12 are essential to clarify the relationship between HHV-6 and MS.